Hard
In this problem, you are given a DNA sequence. Your task is to infer the protein that would be produced by this DNA sequence using the standard genetic code. The DNA sequence will be provided in a single string of A, C, G, and T characters. You need to return the protein sequence.
Given: A DNA sequence P of length at most 10,000 nucleotides.
Return: The protein string corresponding to the transcribed and translated DNA sequence, up to the first stop codon.
Sample Input:
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
Sample Output:
MAIVMGR*KGAR*